pegfp c1 expression vector (Addgene inc)
Addgene inc is a verified supplier 
86
Structured Review
Addgene inc
pegfp c1 expression vector
Pegfp C1 Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+c1+vector/pEGFP-C1-TBP+(Plasmid+%2326674)/pmc12880560-74-7-10
Average 86 stars, based on 3 article reviews
Pegfp C1 Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+c1+vector/pEGFP-C1-TBP+(Plasmid+%2326674)/pmc12880560-74-7-10
Average 86 stars, based on 3 article reviews
pegfp c1 expression vector - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: FMRP regulates MFF translation to locally direct mitochondrial fission in neurons. Article Snippet: .. The following plasmids were used: mito-DsRed2 (a gift from T. Schwarz, Harvard Medical School), EGFP–FMRP (gift from G. Bassell, Emory University), GFP-POLG2 (gift from W. Copeland, NIH), Halo–FMRP (subcloned from EGFP–FMRP into pFN21A-HaloTag-CMV vector from Promega), COX8A–BFP (Goldsmith et al.49), LAMP1–Halo (Gallagher and Holzbaur50), GFP–MFF (Addgene, 49153), GFP-RAB7 (Addgene, 12605), GFP–RAB7 T22N (Addgene, 12660), RFP–RAB5 (Addgene, 14437), EGFP– DRP1 (subcloned from pcDNA 3.1-Drp1 (Addgene, 34706) into Article Title: Endoplasmic reticulum exit sites are segregated for secretion based on cargo size. Article Snippet: The iLID fragment was originally obtained as a generous gift from the Kuhlman lab (Addgene 60411). .. TANGO1Short was amplified using 5’- GATCCGCTAGCGCTACCGGTGCCACCATGGACTCAGTACCTGCC-3’ and 5’-ACTACTACCACTACTACCTGGGCTCTGTTTTAAAGCCTG-3’, mCherry-iLID was amplified using 5’- GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’- TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT3’.The fragments were inserted into a Article Title: Mycobacterium tuberculosis modulates NUDT21-mediated alternative polyadenylation to enhance FTH1 expression in macrophages and promotes intracellular growth Article Snippet: .. The 3′UTRs of FTH1 transcripts were cloned into a Article Title: Endoplasmic reticulum exit sites are segregated for secretion based on cargo size. Article Snippet: .. The fragments were inserted into a Article Title: Endoplasmic reticulum exit sites are segregated for secretion based on cargo size. Article Snippet: .. The fragments were inserted into a Article Title: p53-dependent chromatin relaxation is required for DNA double-strand break repair. Article Snippet: .. The GFP-p53 plasmid was constructed by cloning the full-length cDNA of p53 into a Article Title: Plasma membrane rather than endosomal Gq signaling drives transcriptional activity by the viral chemokine receptor US28 in glioblastoma Article Snippet: C-tRFP-Lck cloned into PCMV6-AC-RFP expression vector was purchased from Origene (#RC100049). .. TagRFP-T-EEA1 in Article Title: p53-dependent chromatin relaxation is required for DNA double-strand break repair Article Snippet: .. The GFP-p53 plasmid was constructed by cloning the full-length cDNA of p53 into a Amplification:Article Title: Endoplasmic reticulum exit sites are segregated for secretion based on cargo size. Article Snippet: The iLID fragment was originally obtained as a generous gift from the Kuhlman lab (Addgene 60411). .. TANGO1Short was amplified using 5’- GATCCGCTAGCGCTACCGGTGCCACCATGGACTCAGTACCTGCC-3’ and 5’-ACTACTACCACTACTACCTGGGCTCTGTTTTAAAGCCTG-3’, mCherry-iLID was amplified using 5’- GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’- TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT3’.The fragments were inserted into a Clone Assay:Article Title: Mycobacterium tuberculosis modulates NUDT21-mediated alternative polyadenylation to enhance FTH1 expression in macrophages and promotes intracellular growth Article Snippet: .. The 3′UTRs of FTH1 transcripts were cloned into a Construct:Article Title: p53-dependent chromatin relaxation is required for DNA double-strand break repair. Article Snippet: .. The GFP-p53 plasmid was constructed by cloning the full-length cDNA of p53 into a Article Title: p53-dependent chromatin relaxation is required for DNA double-strand break repair Article Snippet: .. The GFP-p53 plasmid was constructed by cloning the full-length cDNA of p53 into a Cloning:Article Title: p53-dependent chromatin relaxation is required for DNA double-strand break repair. Article Snippet: .. The GFP-p53 plasmid was constructed by cloning the full-length cDNA of p53 into a Article Title: p53-dependent chromatin relaxation is required for DNA double-strand break repair Article Snippet: .. The GFP-p53 plasmid was constructed by cloning the full-length cDNA of p53 into a |